Primary human T cell isolation and culture

After thawing, T cells were cultured in human T cell medium consisting of X-VIVO 15 (Lonza No. 04-418Q), 5% human AB serum and 10 mM neutralized N-acetyl l-cysteine (Sigma-Aldrich No. A9165); for in vitro assays, medium was supplemented with 30 units per millilitre of IL-2 (NCI BRB Preclinical Repository), and for experiments involving TCR gene knockout, human T cell medium was supplemented with 100 units per millilitre of IL-7 (Miltenyi No. 130-095-362) and 100 units per millilitre of IL-15 (Miltenyi No. 130-095-765).

TCR gene knockout of lentivirally transduced human T cells

For TCR gene knockout experiments, primary T cells were activated and transduced as indicated above. At 24 h post transduction, virus and Dynabeads were removed, and cells were rested for 24 h, and then resuspended at 1 × 10^6 cells per millilitre in P3 electroporation buffer (Lonza No. V4SP-3960) with sgRNA (CAGGGUUCUGGAUAUCUGU) targeting the human TRAC locus and Cas9. A 23 µl volume of this mixture was aliquoted to each well of a 96-well nucleofection plate (Lonza No. V4SP-3960) and immediately electroporated using a 4D Lonza Nucleofector with program EH-115. Cells were resuspended in pre-warmed human T cell medium and recovered for 30 min in the incubator before being transferred to culture. Electroporated cells were assessed for TCR gene knockout and lentiviral transduction through flow before injection into mice.

CARD11 and BCL10 CRISPR knockout
CRISPR knockout was carried out in triple-reporter Jurkat cells using the SE Cell Line 4D-Nucleofector Kit (Lonza). A total of 1 × 10^6 cells were nucleofected with Cas9 alone or ribonuclear protein complexes of Cas9 with CARD11 gRNA (CAATGACCTTACACTGACGC) or BCL10 gRNA (TCGCCGAATAGATTCAACAA).