citations

                    Optimizing the procedure for manufacturing clinical-grade genetically manipulated natural killer cells for adoptive immunotherapy
                

Authors:

Lin H, Ye S, Zhang S, Ge T, Li D, Huang L, Zhu L, Mu W

In:

Source: Cytotherapy
Publication Date: (2024)
Issue: S1465: 3249(24)00902-2

Research Area:

Cancer Research/Cell Biology

Immunotherapy / Hematology

Basic Research

Molecular Biology

Regenerative medicine

Drug Discovery

Cells used in publication:

Natural killer Cells (NK), human: Species: human; Tissue Origin: blood

Culture Media:

X-VIVO

Platform:

4D-Nucleofector® X-Unit

Experiment

B2M gene knockout in NK cells
NK cells were harvested, washed once with phosphate-buffered saline and prepared for electroporation. RNP complexes were assembled immediately before electroporation by combining 7 µg of Cas9 protein (Kactus Biosystems, Shanghai, China) with 3 µg of sgRNA targeting B2M (sequence: CGTGAGTAAACCTGAATCTT, synthesized by Genscript, Nanjing, China) and incubating the mixture at room temperature for 15 minutes. The cell-RNP mixture was then transferred to an electroporation cuvette and subjected to electroporation using the DN-100 program on a 4D-Nucleofector (Lonza). After electroporation, NK cells were incubated in pre-warmed medium and cultured further.

Abstract

Background aims: Ex vivo-expanded natural killer (NK) cells hold significant potential as antitumor effector cells for adoptive immunotherapy. However, producing clinical-grade, genetically modified NK cells in sufficient quantities presents a considerable challenge.

Methods: We tested RPMI 1640, KBM581, SCGM, NK MACS, X-VIVO 15 and AIM-V, each supplemented with fetal bovine serum, human AB serum, human platelet lysate or Immune Cell Serum Replacement (SR) combined with feeder cells, to produce cytotoxic NK cells. Subsequent analyses were conducted to assess cell viability, expansion folds, cytotoxicity, immunophenotype and transcriptome profile of NK cells under certain conditions. Furthermore, transfer plasmids varying in transgene size, promoter elements, backbones and packaging plasmids with different envelopes were used to transduce NK cells, and differences in transduction efficiency were compared. Nucleofection was performed every 2 days from day 0 to day 12 to determine the optimal time window for gene editing.

Results: NK cells cultured in KBM581 medium supplemented with serum replacement exhibited the best expansion, achieving greater than 5000-fold increase within 2 weeks and exceeding 25 000-fold expansion within 3 weeks. In addition, NK cells cultured in KBM581 medium with human AB serum demonstrated the greatest cytolytic activities and exhibited greater expression of NKp30, 2B4, PRF1, granzyme B and IL2RG. Baboon envelope pseudotyped lentivirus outperformed baboon envelope-vesicular stomatitis virus type G hybrid envelope lentivirus, achieving robust NK-cell transduction. In addition, efficient gene knockout efficiency was achieved in NK cells on day 4 to day 6 post feeder cell activation using the LONZA DN-100 program, which can strike a balance between editing efficiency and cell expansion.

Conclusions: This research presents a Good Manufacturing Practice-compliant protocol using a feeder cell expansion system for the large-scale production of highly cytotoxic NK cells. The protocol facilitates genetic modification of these cells, positioning them as promising candidates for universal therapeutic applications in immunotherapy.

Open in PubMed