citations

                    Degradation of IKZF1 prevents epigenetic progression of T cell exhaustion in a novel antigen-specific assay 
                

Authors:

Tristan Tay, Gayathri Bommakanti, Elizabeth Jaensch, Aparna Gorthi, Iswarya Karapa Reddy, Yan Hu, Ruochi Zhang, Aatman Doshi, Sin Lih Tan, Verena Brucklacher-Waldert, Laura Prickett, James Kurasawa, Michael Glen Overstreet, Steven Criscione, Jason Daniel Buenrostro, Deanna A. Mele

In:

Source: Cell Rep Med
Publication Date: (2024)
Issue: 5(11): 101804

Research Area:

Cancer Research/Cell Biology

Immunotherapy / Hematology

Gene Expression

Basic Research

Molecular Biology

Drug Discovery

Cells used in publication:

T cell, human stim.: Species: human; Tissue Origin: blood

Platform:

384-well HT Nucleofector® System

Experiment

Arrayed CRISPRko screen in T cells:

The screen was performed at Revvity in Cambridge, UK. CD3+ T cells were isolated by magnetic bead separation (StemCell Technology) from PBMCs of three leukopaks (Cambridge Biosciences) and cryopreserved. Revived CD3+ T cells were resuspended in P3 buffer (Lonza) and electroporated (Amaxa HT Nucleofector; Lonza) in a 1:3 v/v ratio of Cas9-NLS (Feldan) and a synthetic sgRNA library targeting 829 genes (3 guides per gene, Revvity Dharmacon). The library used consisted of the Edit-R Human sgRNA Library-Epigenetics (QTE2954349G) and Edit-R Human Synthetic B2M (67), CBLB (8680), Rosa26 (custom synthesis using following gRNA sequence AGTCGCTTCTCGATTATGGG), non-targeting control (NTC) #1, and lethal synthetic sgRNA control #1 (all 3 guides per gene, Revvity Dharmacon). Immediately after electroporation, each well was transferred to RPMI media supplemented with heat-inactivated FBS, Pen/Strep, HEPES, non-essential amino acids, sodium pyruvate, Glutamax and 2-mercapto-ethanol (all Gibco) and splitted into four technical replicates with 20,000 cells per well of a 384 well culture plate. Cells were stimulated with ImmunoCult Human CD3/CD28 T Cell Activator Mix (1:80; StemCell Technology) and incubated at 37°C. Three days after the first stimulation, cells were spun down and supernatant was removed. This was followed by a second, third and fourth round of stimulation every three days with fresh ImmunoCult Human CD3/CD28 T Cell Activator Mix (1:80) resuspended.

Abstract

In cancer, chronic antigen stimulation drives effector T cells to exhaustion, limiting the efficacy of T cell therapies. Recent studies have demonstrated that epigenetic rewiring governs the transition of T cells from effector to exhausted states and makes a subset of exhausted T cells non-responsive to PD1 checkpoint blockade. Here, we describe an antigen-specific assay for T cell exhaustion that generates T cells phenotypically and transcriptionally similar to those found in human tumors. We perform a screen of human epigenetic regulators, identifying IKZF1 as a driver of T cell exhaustion. We determine that the IKZF1 degrader iberdomide prevents exhaustion by blocking chromatin remodeling at T cell effector enhancers and preserving the binding of AP-1, NF-?B, and NFAT. Thus, our study uncovers a role for IKZF1 as a driver of T cell exhaustion through epigenetic modulation, providing a rationale for the use of iberdomide in solid tumors to prevent T cell exhaustion.

Open in PubMed