citations

Oncolytic virus-derived type I interferon restricts CAR T cell therapy

Authors:

Evgin L, Huff AL, Wongthida P, Thompson J, Kottke T, Tonne J, Schuelke M, Ayasoufi K, Driscoll CB, Shim KG, Reynolds P, Monie DD, Johnson AJ, Coffey M, Young SL, Archer G, Sampson J, Pulido J, Perez LS, Vile R.

In:

Source: Nat Commun.
Publication Date: (2020)
Issue: Jun 24;11(1): 3187. doi: 10.1038/s41467-020-17011-z

Research Area:

Immunotherapy / Hematology

Cells used in publication:

T cell, human stim.: Species: human; Tissue Origin: blood

Platform:

4D-Nucleofector® X-Unit

Experiment

Cas9 RNP mediated editing of CAR T cells

Two IFNAR1 targeting crRNAs (Mm.Cas9.IFNAR1.1.AA (TCAGTTACACCATACGAATC) and Mm.Cas9. IFNAR1.1.AB (GCTTCTAAACGTACTTCTGG)) and Alt-R CRISPR-Cas9 Negative Control crRNAs #1 and #2 were ordered from Integrated DNA Technologies (IDT). Alt-R crRNA and Alt-R tracrRNA duplexes were prepared at equimolar concentrations and annealed at 95 °C for 5 min. 150 pmol of each duplex was precomplexed with 120 pmol TrueCut Cas9 Protein v2 (Thermo Fisher Scientific)
for 10–20 min to modify 1 × 107 cells. T cells were mixed with RNP complex and Cas9 Electroporation Enhancer (4 uM, IDT). Nucleofection was performed using the Amaxa P4 Primary Cell kit and 4D-Nucleofecter (Lonza) using the program CM137.

Abstract

The application of adoptive T cell therapies, including those using chimeric antigen receptor (CAR)-modified T cells, to solid tumors requires combinatorial strategies to overcome immune suppression associated with the tumor microenvironment. Here we test whether the inflammatory nature of oncolytic viruses and their ability to remodel the tumor microenvironment may help to recruit and potentiate the functionality of CAR T cells. Contrary to our hypothesis, VSVmIFNß infection is associated with attrition of murine EGFRvIII CAR T cells in a B16EGFRvIII model, despite inducing a robust proinflammatory shift in the chemokine profile. Mechanistically, type I interferon (IFN) expressed following infection promotes apoptosis, activation, and inhibitory receptor expression, and interferon-insensitive CAR T cells enable combinatorial therapy with VSVmIFNß. Our study uncovers an unexpected mechanism of therapeutic interference, and prompts further investigation into the interaction between CAR T cells and oncolytic viruses to optimize combination therapy.

Open in PubMed