Novel humanized loss-of-function NF1 mouse model of juvenile myelomonocytic leukemia

Authors:
Sinha R, Patil RV, Romano R, Sharma D, Lee E, Perriman R, Takeda S, Lesch BJ, Yao Z, Liu YL, Cromer MK, Porteus MH, Bertaina A.
In:
Source: Blood Adv
Publication Date: (2026)
Issue: :
Research Area:
Cancer Research/Cell Biology
Immunotherapy / Hematology
Gene Expression
Basic Research
Molecular Biology
Regenerative medicine
Drug Discovery
Cells used in publication:
CD34+ cell, human
Species: human
Tissue Origin: blood
Platform:
4D-Nucleofector® X-Unit
Experiment

In vitro knockout (KO) of human NF1 gene in UCB HSPCs
We designed 3 guide RNAs targeting the exon 2 of the human NF1 gene from Synthego, (single guide RNA[sgRNA]_1: AGUCAGUACUGAGCACAACA; sgRNA_2: AAGUUUUCUUUGGUUAUAAG; and sgRNA_3: CAUUCUUUAAAAUAGUAGUG). CRISPR/Cas9 editing was performed in vitro using all 3 guide RNAs and high-fidelity Cas9 enzyme (Hi-Fi Cas9; catalog no. 1081061, Integrated DNA Technologies) at a 1:1 ratio to knock out the human NF1 gene in expanded CD34 + cells. Electroporation was performed on HSPCs in P3 primary cell nucleofection solution (catalog no. V4XP-3032, Lonza) on the Lonza 4D-Nucleofector X unit, with DZ-100 program (for CD34 + human cells). 19 Cells were recovered in HSPCs media. Cells were transferred onto 24-well culture plates at 100 000 cells per mL concentration and cultured under hypoxia conditions for 48 hours (37 ? C, 5% CO 2 , 5% O 2 ).

Abstract

Juvenile myelomonocytic leukemia (JMML) is a fatal pediatric cancer characterized by classical features such as splenomegaly, monocytosis, and granulocyte-macrophage colony-stimulating factor (GM-CSF) hypersensitivity, with RAS pathway mutations being the major drivers. Mutations causing loss-of-function of the Neurofibromin 1 gene (NF1LOF) occur in ~20% of patients with JMML. NF1LOF drives upregulation of RAS/MAPK/PI3K pathways that leads to aggressive proliferation/differentiation of immature myeloid cells. Hematopoietic stem cell transplantation is the only curative option, but relapse occurs in ~50% of patients, indicating an urgent need for novel and targeted therapeutic strategies. However, low patient sample availability and a lack of reliable disease models have made it difficult to study and treat JMML. Using CRISPR/Cas9, we have generated NF1LOF in human umbilical cord blood-derived hematopoietic stem and progenitor cells (HSPCs). We achieved a high gene knockout rate of ~89% and concomitant loss of NF1 protein in the modified HSPCs. Importantly, NF1LOF cells displayed marked GM-CSF hypersensitivity in in vitro colony-forming unit assays, mirroring JMML. When transplanted into NSG-SGM3 mice, they caused rapid lethality (median survival of 32 days), myeloid expansion, tissue infiltration (spleen, liver, and lungs), and specific upregulation of RAS/MAPK pathway and STAT5 genes, consistent with patient profiles. This first humanized NF1LOF mouse model recapitulates key JMML features, enabling investigation of disease mechanisms and targeted therapies.