Cas9/RNP electroporation for targeting AAVS1 in NK cells:  AAVS1 was targeted using gRNA (crRNA: 50GGGGCCACTAGGGACAGGAT) via electroporation of Cas9/RNP into NK cells seven days after stimulation with FC21 as described before (Naeimi Kararoudi et al., 2018). Briefly, 3 x 10^6 expanded NK cells were harvested and washed twice with 13 mL of PBS followed by centrifugation for 5 min at 400 g and aspiration of PBS. The cell pellet was resuspended in 20µl of P3 Primary Cell 4D-Nucleofector Solution. 5ul of pre-complexed Cas9/RNP (Alt-R CRISPR-Cas9 crRNA, Alt-R CRISPR-Cas9 tracrRNA, or preassembled synthetic sgRNA (Synthego, Menlo Park, CA) and Alt-R S.p. HiFi Cas9 Nuclease V3) (Integrated DNA Technologies, Inc., Coralville, Iowa), targeting AAVS1 and 1µl of 100µM electroporation enhancer (Alt-R Cas9
Electroporation Enhancer) were added to the cell suspension. The total volume of 26ul of CRISPR reaction was transferred into 4D Nucleofector TM 16-well Strip and electroporated using program EN-138. After electroporation, the cells were transferred into 2mL of media containing 50 IU of IL-2 in a 12 well plate and incubated at 37 degrees and 5% CO2 pressure.

Combining Cas9/RNP and AAV6 to generate mCherry and CAR NK cells:  A media change and resuspension at 5 x 10^5 cells per mL was performed on day 6 of NK cell expansion one day before experimental manipulation. The NK cells were electroporated with Cas9/RNP targeting AAVS1 on day 7, as described above. Thirty minutes after electroporation, 3 x 10^5 live cells were collected and resuspended at 1 x 10^6 cells per mL in media containing 50 IU IL2 (Novartis) in a 24 well plate in a total volume of 300µl. For each transduction condition with ssAAV6 or scAAV6 to deliver HDR or CRISPaint DNA encoding mCherry or CD33CARs, we transduced 3 x 10^5 electroporated cells with 300K MOI (10-500K MOI if needed). Negative controls included as NK cells that were not electroporated, or were electroporated with Cas9/RNP but not AAV transduced, or were transduced with 300K MOI of AAV6 without electroporation of Cas9/RNP. The day after electroporation and transduction, we added 300µl of fresh media containing 50 IU of IL2 to each well without changing the old media. The cells were kept in culture for 48 h after electroporation and were then re-stimulated with 2 x 10^6 feeder cells and kept in a total volume of 2 mL media containing 50 IU in 12 well plate, without changing the old media. 48 h later, 8 mL fresh media supplemented with IL2 was added to cells, a total volume of 10 mL was kept in a T25 flask. At day 7 post-transduction, cells were re-stimulated with feeder cells at a ratio of 1:1 and grown for one more week, every 2 days fresh media was added to the cells.